Przyrodniczy serwis edukacyjny Biolog.pl
Ogólnopolski Dziennik BIOLOG - strona główna Największe polskie forum przyrodnicze i naukowe Korepetycje Matura 2014 Studia 2014 Ściągi Baza konkursów Festiwale naukowe Książki Księgarnia Fotografia przyrodnicza Multimedia Praca forum przyrodnicze
   Bądź na bieżąco z wydarzeniami, subskrybuj kanały RSS
     Zobacz inne kanały tematyczne RSS dziennika BIOLOG
Aktualności naukowe Biotechnologia Botanika Nauka w Polsce i na świecie Ekologia Leśnictwo Medycyna Zoologia Encyklopedia naukowa GMO - Organizmy modyfikowane genetycznie Świńska grypa forum naukowe



Utwórz nowy wątek Odpowiedz w wątku  [ Posty: 10 ] 
Autor Wiadomość
PostNapisane: 4 wrz 2010, o 18:29 

Dołączył(a): 4 wrz 2010, o 16:56
Posty: 4
Płeć: brak
Witam !

Chciałabym zapytać czy dobrze rozmuję to oto zadanie :

1) Kolejność nukleotydów w pewnej nici DNA jest następująca : ACTTGCAAAGCCTATAGAAC

a) Dopisz nić komplementarną DNA :
Nić matrycowa DNA :
ACTTGCAAAGCCTATAGAAC
Nić komlementarna DNA :
TGAACGTTTCGGATATCTTG

b) Dopisz nić komplementarną RNA :

Czyli powtórnie przepisuję nić matrycową DNA ?
ACTTGCAAAGCCTATAGAAC
Nić komplementarna RNA :
UGUUCGUUUCGGUUAUCUUG
Wydaje mi się, iż tutaj nastąpiła transkrypcja - czy mam rację ? Czy muszę na nici RNA dopisać tutaj start i stop oraz podpisać trójki nukleotydów ?

Z góry dziękuję za pomoc !


Góra
  
 
PostNapisane: 4 wrz 2010, o 20:17 
Moderator
Avatar użytkownika

Dołączył(a): 13 lut 2007, o 14:01
Posty: 3837
Lokalizacja: Siedlce
Płeć: Kobieta
pytajnikkk napisał(a):
Witam !

Chciałabym zapytać czy dobrze rozmuję to oto zadanie :

1) Kolejność nukleotydów w pewnej nici DNA jest następująca : ACTTGCAAAGCCTATAGAAC

a) Dopisz nić komplementarną DNA :
Nić matrycowa DNA :
ACTTGCAAAGCCTATAGAAC
Nić komlementarna DNA :
TGAACGTTTCGGATATCTTG

Dobrze
Cytuj:
b) Dopisz nić komplementarną RNA :

Czyli powtórnie przepisuję nić matrycową DNA ?
ACTTGCAAAGCCTATAGAAC
Nić komplementarna RNA :
UGUUCGUUUCGGUUAUCUUG
SPRAWDŻ
UGAACGUUUCGGAUAUCUUG
Cytuj:
Wydaje mi się, iż tutaj nastąpiła transkrypcja - czy mam rację ?
TAK
Cytuj:
Czy muszę na nici RNA dopisać tutaj start i stop oraz podpisać trójki nukleotydów ?
nie


Góra
  
 
PostNapisane: 4 wrz 2010, o 22:29 

Dołączył(a): 4 wrz 2010, o 16:56
Posty: 4
Płeć: brak
b) Dopisz nić komplementarną RNA :

Czyli powtórnie przepisuję nić matrycową DNA ?
ACTTGCAAAGCCTATAGAAC
Nić komplementarna RNA :
UGUUCGUUUCGGUUAUCUUG

Dlaczego ten wytłuszczony fragment jest źle ? Skoro przepisuję z DNA na RNA to na RNA mam A-U i C-G, prawda ? I dlaczego na owej nici nie piszę START, STOP oraz nie podpisuję trójek nukleotydów ?

Dziękuję !


Góra
  
 
PostNapisane: 4 wrz 2010, o 23:04 
Moderator
Avatar użytkownika

Dołączył(a): 13 lut 2007, o 14:01
Posty: 3837
Lokalizacja: Siedlce
Płeć: Kobieta
A-U
T-A
C-G
G-C
UGUUCGUUUCGGUUAUCUUG
Sprawdź
Czyli powtórnie przepisuję nić matrycową DNA ?
Dlaczego powtórnie? To jest tylko zadanie sprawdzające czy znasz zasady kodowania informacji genetycznej. Tworzenie komplementarnej nici DNA to właśnie sprawdzenie czy wiesz o co chodzi
I dlaczego na owej nici nie piszę START, STOP oraz nie podpisuję trójek nukleotydów ?
Bo to jest zadanie. Średnia długość genu np. u człowieka to 1000 nukleotydów a nie 20 jak w twoim i jest to fragment nici DNA a nie gen


Góra
  
 
PostNapisane: 5 wrz 2010, o 12:12 

Dołączył(a): 4 wrz 2010, o 16:56
Posty: 4
Płeć: brak
Witam !

Z góry dziękuję za odpowiedź !

Chciałam zapytać jeszcze o jedno : wiemy, ze DNA jest dwuniciowe i zawiera w sobie informację genetyczną danego osobnika oraz mieści się w jądrze komórkowym i nie może go opuścić, ale wysyła 'sygnały' za pomocą małych wypustek w cytoplaźmie - mRNA, tzw. messengerem.

Moje pytanie brzmi :
a) Czym różni się nić matrycowa od komplementarnej ?
b) W jakim celu dokonuje się tworzenia tych doatkowych nici czyli kolejnego przepisania ? Po to by geny się rozprzestrzeniły po organiźmie ? Nie rozumiem istosty transkrypcji i translacji.
c) Czy mylę się myśląc iż, DNA buduje gen ? Czym różni się DNA od genu, że na pierwszym nie zaznaczamy START/STOP czy nie oznaczamy trójek nukleotydów ?

Dziękuję !


Góra
  
 
PostNapisane: 6 wrz 2010, o 19:41 
Moderator
Avatar użytkownika

Dołączył(a): 13 lut 2007, o 14:01
Posty: 3837
Lokalizacja: Siedlce
Płeć: Kobieta
a) Czym różni się nić matrycowa od komplementarnej ?

nić komplementarna to inaczej nić kodująca. Na niej właśnie jest zakodowany dany gen (geny). Przepisujemy z matrycowej by na mRNA była taka sama informacja jak w DNA.
Jądro to ,,sejf'' w którym jest przechowywana informacja genetyczna (plany). Ta informacja będzie wielokrotnie wykorzystywana przy produkcji różnych białek.
DNA ma dwie nici - to tak jakby był oryginał informacji i kopia (negatyw)


b) W jakim celu dokonuje się tworzenia tych doatkowych nici czyli kolejnego przepisania ?

Fabryka białka znajduje się w cytoplażmie - to rybosomy. Białka muszą być tworzone na podstawie planów, te plany są w sejfie (jądrze). Musimy zrobić kopię, która jako jednoniciowa bez problemu opuści jądro i podąży do rybosomów (fabryki). tą kopią jest pojedyńcza cząsteczka mRNA. W rzeczywistości ma ona kodon start i stop. W zadaniach się tego nie uwzględnia.

Po to by geny się rozprzestrzeniły po organiźmie ? Nie rozumiem istosty transkrypcji i translacji.

Po to by tworzyć białka: strukturalne (budujące), funkcjonalne (enzymy, hormony) Wszystko inne możemy pobrać i wbudować. Białka tworzymy. Dzięki temu rozwijamysię, rośniemy,....

c) Czy mylę się myśląc iż, DNA buduje gen ? Czym różni się DNA od genu, że na pierwszym nie zaznaczamy START/STOP czy nie oznaczamy trójek nukleotydów ?

hm...
Człowiek w komórce ciała ma 46 chromosomów. Czyli ma 46 cząsteczek DNA. W każdej cząsteczce DNA jest wiele genów ''ułożonych liniowo''. To tak jak kolejne zdania w opowiadaniu. Zaczynają się dużą literą (kodon start) a kończą kropką (kodon stop).


Cytuj:
ale wysyła 'sygnały' za pomocą małych wypustek w cytoplaźmie - mRNA, tzw. messengerem.

To nie są wypuski tylko kopie DNA.


Góra
  
 
PostNapisane: 7 wrz 2010, o 20:11 

Dołączył(a): 4 wrz 2010, o 16:56
Posty: 4
Płeć: brak
Witam !

Z góry dziękuję za odpowiedź !

1) Nić komplementarna to inaczej nić kodująca.
2) Nić komlepentarna to nić wiodąca, a może jest nią matrycowa ?

Znasz następującą sekwencję aminokwasów : ASP. HIS. SER. LEU.
a) Wskaż nić mRNA, na której ten peptyd powstał.
b) Wskaż nić wiodącą DNA


Najpierw podaję nić ( jaką ? ) mRNA :

GAUCAUUCUUUA ( na podstawie tabeli) Czy na tej nici mam pisać START i STOP oraz nazwy trójek nukleotydów ?

I teraz jaj nazwać tą drugą nić, którą będę tworzyć do mRNA ?
CUAGUAAGAAAU Czy coś tu zaznaczam ?

B) Teraz nie wiem, którą nić obrać za bazę do utoworzenia owego podpunktu ...

* Chciałam także zapytać po co koduje się owe białka ? W obronie czy ochronie przed czym ?

Bardzo dziękuję za pomoc !


Góra
  
 
PostNapisane: 8 wrz 2010, o 15:27 
Moderator
Avatar użytkownika

Dołączył(a): 13 lut 2007, o 14:01
Posty: 3837
Lokalizacja: Siedlce
Płeć: Kobieta
Cytuj:
1) Nić komplementarna to inaczej nić kodująca.

Nie
Do nici kodującej komplementarna jest nić matrycowa
Do nici matrycowej komplementarna jest nić kodująca
Zależy którą masz podaną w zadaniu.

Cytuj:
2) Nić komlepentarna to nić wiodąca, a może jest nią matrycowa ?

Replikacja nici DNA odbywa się w obu kierunkach więc raz nicią wiodącą jest matryca a raz nić kodująca.

Cytuj:
Znasz następującą sekwencję aminokwasów : ASP. HIS. SER. LEU.
a) Wskaż nić mRNA, na której ten peptyd powstał.


ASP. HIS. SER. LEU.
GAUCAUUCUUAA - mRNA

CTAGTAAGAATT - DNA nic matrycowa
GATCATTCTTAA - DNA nić kodująca

Cytuj:
Czy na tej nici mam pisać START i STOP oraz nazwy trójek nukleotydów ?

Po co ja pisałam wcześniejsze posty?
Niestouje się dodawania kodonów start i stop, chyba że nauczyciel twój tego wymaga.

Cytuj:
I teraz jaj nazwać tą drugą nić, którą będę tworzyć do mRNA ?
CUAGUAAGAAAU Czy coś tu zaznaczam ?


Nauczyciel aby sprawdzić czy wiesz i rozumiesz każe ci na podstawie RNA stworzyć nić DNA czyli przeprowadzić odwrotną transkrypcję.
Jeśli rozumiesz transkrypcję to to jest odwrotnie.


Cytuj:
Teraz nie wiem, którą nić obrać za bazę do utoworzenia owego podpunktu ...

masz matrycową to tworzysz kodującą
Cytuj:
b) Wskaż nić wiodącą DNA

Pojęcie nici wiodącej dotyczy replikacji a to nie ma związku z biosyntezą białka.

Cytuj:
* Chciałam także zapytać po co koduje się owe białka ? W obronie czy ochronie przed czym ?

Dlaczego nie czytasz postów?
Cytuj:
Po to by tworzyć białka: strukturalne (budujące), funkcjonalne (enzymy, hormony) Wszystko inne możemy pobrać i wbudować. Białka tworzymy. Dzięki temu rozwijamysię, rośniemy,....


Jak zjesz czekoladę to w komórkach twojej trzustki zachodzi transkrypcja genu kodującego insulinę i translacja dzięki której powstaje białko - insulina.
Poczytajsobie o roli białek. Informacja o budowie naszych białek zawarta jest w DNA.



Bardzo dziękuję za pomoc !


Góra
  
 
PostNapisane: 4 wrz 2011, o 11:01 

Dołączył(a): 4 wrz 2011, o 10:55
Posty: 2
Płeć: brak
Witam, mam pytanie..
Dlaczego w definicji genu nie uwzględniono kolejności nukleotydów w kwasie RNA? baardzo proszę o szybką odpowiedź ;)


Góra
  
 
PostNapisane: 20 lut 2013, o 01:38 

Dołączył(a): 20 lut 2013, o 01:34
Posty: 2
Płeć: brak
malgosi35, Dobry wieczor pisze z taka prosba czy mogla bys mi pomoc w napisaniu nici komplementarnej?? Siedze nad tym zadaniem i kilkoma jeszcze od 20 i wymiekam.
Podaje nić wyjsciowa: ATTTGCGCTAGCTACCCTAGACCTTT
Z gory dziekuje za pomoc


Góra
  
 
Utwórz nowy wątek Odpowiedz w wątku  [ Posty: 10 ] 

Poznaj kierunki studiów, opinie studentów, pytania i odpowiedzi maturzystów na studia.biolog.pl
(informator na temat kierunków: biologia, biotechnologia, medycyna, weterynaria, ochrona środowiska, mikrobiologia...)


W naszym portalu:  Zoologia i zwierzęta | olimpiada ekologiczna | Mikroskopy
Matura 2014: matura z biologii, arkusze maturalne z biologii, testy maturalne z biologii, testy z biologii, Wyniki próbnej matury z matematyki, Kursy przygotowawcze na studia medyczne, Kursy przygotowawcze do matury 2014
Aktualne na forum: jak zrobić zielnik, świńska grypa w Polsce, Zadania domowe z biologii, Edukacja ekologiczna

Na bazie phpBB
© Platforma edukacyjna BIOAREA | Ogólnopolski Dziennik BIOLOG
Redakcja | REKLAMA | Regulamin, ochrona prywatności
Letnia Szkoła Mikroskopii Optycznej 2014
AKTUALNOŚCI

Cena: 5,00 zł
Śląski Uniwersytet Medyczny w Katowicach
Gdański Uniwersytet Medyczny
Uniwersytet Medyczny w Lublinie
Uniwersytet Medyczny w Łodzi
Uniwersytet Medyczny w Poznaniu
Warszawski Uniwersytet Medyczny
Pomorski Uniwersytet Medyczny
Akademia Medyczna we Wrocławiu
Collegium Medicum w Bydgoszczy
Collegium Medicum Uniwersytetu Jagiellońskiego
Uniwersytet Warmińsko-Mazurski w Olsztynie
Uniwersytet Medyczny w Białymstoku
 Oferty pracy
 w biolog.pl
 Znajdź pracę (350328 ofert pracy)

  

  

  
 
  Praca dla biologa, praca dla biotechnologa, praca dla nauczyciela
Na skróty: matura 2014, progi, limity, arkusze maturalne, przecieki



przewodnik dla maturzystów - kierunki studiów studia biologia studia biotechnologia leśnictwo studia medycyna studia ochrona środowiska studia weterynaria studia studia