Przyrodniczy serwis edukacyjny
Ogólnopolski Dziennik BIOLOG - strona główna Największe polskie forum przyrodnicze i naukowe Korepetycje Matura 2013 Studia 2013 Ściągi Baza konkursów Festiwale naukowe Książki Księgarnia Fotografia przyrodnicza Multimedia Praca forum przyrodnicze
   Bądź na bieżąco z wydarzeniami, subskrybuj kanały RSS
     Zobacz inne kanały tematyczne RSS dziennika BIOLOG
   Forumowe dyskusje » Chat
Aktualności naukowe Biotechnologia Botanika Nauka w Polsce i na świecie Ekologia Leśnictwo Medycyna Zoologia Encyklopedia naukowa GMO - Organizmy modyfikowane genetycznie Świńska grypa forum naukowe
Teraz jest 24 kwi 2014, o 16:01

Utwórz nowy wątek Odpowiedz w wątku  [ Posty: 10 ] 
Autor Wiadomość
PostNapisane: 4 wrz 2010, o 18:29 

Dołączył(a): 4 wrz 2010, o 16:56
Posty: 4
Płeć: brak
Gadu-Gadu: 0
Witam !

Chciałabym zapytać czy dobrze rozmuję to oto zadanie :

1) Kolejność nukleotydów w pewnej nici DNA jest następująca : ACTTGCAAAGCCTATAGAAC

a) Dopisz nić komplementarną DNA :
Nić matrycowa DNA :
Nić komlementarna DNA :

b) Dopisz nić komplementarną RNA :

Czyli powtórnie przepisuję nić matrycową DNA ?
Nić komplementarna RNA :
Wydaje mi się, iż tutaj nastąpiła transkrypcja - czy mam rację ? Czy muszę na nici RNA dopisać tutaj start i stop oraz podpisać trójki nukleotydów ?

Z góry dziękuję za pomoc !

 Zobacz profil  
PostNapisane: 4 wrz 2010, o 20:17 
Avatar użytkownika

Dołączył(a): 13 lut 2007, o 14:01
Posty: 3819
Lokalizacja: Siedlce
Płeć: Kobieta
pytajnikkk napisał(a):
Witam !

Chciałabym zapytać czy dobrze rozmuję to oto zadanie :

1) Kolejność nukleotydów w pewnej nici DNA jest następująca : ACTTGCAAAGCCTATAGAAC

a) Dopisz nić komplementarną DNA :
Nić matrycowa DNA :
Nić komlementarna DNA :

b) Dopisz nić komplementarną RNA :

Czyli powtórnie przepisuję nić matrycową DNA ?
Nić komplementarna RNA :
Wydaje mi się, iż tutaj nastąpiła transkrypcja - czy mam rację ?
Czy muszę na nici RNA dopisać tutaj start i stop oraz podpisać trójki nukleotydów ?

Wszystko jest możliwe......

 Zobacz profil  
PostNapisane: 4 wrz 2010, o 22:29 

Dołączył(a): 4 wrz 2010, o 16:56
Posty: 4
Płeć: brak
Gadu-Gadu: 0
b) Dopisz nić komplementarną RNA :

Czyli powtórnie przepisuję nić matrycową DNA ?
Nić komplementarna RNA :

Dlaczego ten wytłuszczony fragment jest źle ? Skoro przepisuję z DNA na RNA to na RNA mam A-U i C-G, prawda ? I dlaczego na owej nici nie piszę START, STOP oraz nie podpisuję trójek nukleotydów ?

Dziękuję !

 Zobacz profil  
PostNapisane: 4 wrz 2010, o 23:04 
Avatar użytkownika

Dołączył(a): 13 lut 2007, o 14:01
Posty: 3819
Lokalizacja: Siedlce
Płeć: Kobieta
Czyli powtórnie przepisuję nić matrycową DNA ?
Dlaczego powtórnie? To jest tylko zadanie sprawdzające czy znasz zasady kodowania informacji genetycznej. Tworzenie komplementarnej nici DNA to właśnie sprawdzenie czy wiesz o co chodzi
I dlaczego na owej nici nie piszę START, STOP oraz nie podpisuję trójek nukleotydów ?
Bo to jest zadanie. Średnia długość genu np. u człowieka to 1000 nukleotydów a nie 20 jak w twoim i jest to fragment nici DNA a nie gen

Wszystko jest możliwe......

 Zobacz profil  
PostNapisane: 5 wrz 2010, o 12:12 

Dołączył(a): 4 wrz 2010, o 16:56
Posty: 4
Płeć: brak
Gadu-Gadu: 0
Witam !

Z góry dziękuję za odpowiedź !

Chciałam zapytać jeszcze o jedno : wiemy, ze DNA jest dwuniciowe i zawiera w sobie informację genetyczną danego osobnika oraz mieści się w jądrze komórkowym i nie może go opuścić, ale wysyła 'sygnały' za pomocą małych wypustek w cytoplaźmie - mRNA, tzw. messengerem.

Moje pytanie brzmi :
a) Czym różni się nić matrycowa od komplementarnej ?
b) W jakim celu dokonuje się tworzenia tych doatkowych nici czyli kolejnego przepisania ? Po to by geny się rozprzestrzeniły po organiźmie ? Nie rozumiem istosty transkrypcji i translacji.
c) Czy mylę się myśląc iż, DNA buduje gen ? Czym różni się DNA od genu, że na pierwszym nie zaznaczamy START/STOP czy nie oznaczamy trójek nukleotydów ?

Dziękuję !

 Zobacz profil  
PostNapisane: 6 wrz 2010, o 19:41 
Avatar użytkownika

Dołączył(a): 13 lut 2007, o 14:01
Posty: 3819
Lokalizacja: Siedlce
Płeć: Kobieta
a) Czym różni się nić matrycowa od komplementarnej ?

nić komplementarna to inaczej nić kodująca. Na niej właśnie jest zakodowany dany gen (geny). Przepisujemy z matrycowej by na mRNA była taka sama informacja jak w DNA.
Jądro to ,,sejf'' w którym jest przechowywana informacja genetyczna (plany). Ta informacja będzie wielokrotnie wykorzystywana przy produkcji różnych białek.
DNA ma dwie nici - to tak jakby był oryginał informacji i kopia (negatyw)

b) W jakim celu dokonuje się tworzenia tych doatkowych nici czyli kolejnego przepisania ?

Fabryka białka znajduje się w cytoplażmie - to rybosomy. Białka muszą być tworzone na podstawie planów, te plany są w sejfie (jądrze). Musimy zrobić kopię, która jako jednoniciowa bez problemu opuści jądro i podąży do rybosomów (fabryki). tą kopią jest pojedyńcza cząsteczka mRNA. W rzeczywistości ma ona kodon start i stop. W zadaniach się tego nie uwzględnia.

Po to by geny się rozprzestrzeniły po organiźmie ? Nie rozumiem istosty transkrypcji i translacji.

Po to by tworzyć białka: strukturalne (budujące), funkcjonalne (enzymy, hormony) Wszystko inne możemy pobrać i wbudować. Białka tworzymy. Dzięki temu rozwijamysię, rośniemy,....

c) Czy mylę się myśląc iż, DNA buduje gen ? Czym różni się DNA od genu, że na pierwszym nie zaznaczamy START/STOP czy nie oznaczamy trójek nukleotydów ?

Człowiek w komórce ciała ma 46 chromosomów. Czyli ma 46 cząsteczek DNA. W każdej cząsteczce DNA jest wiele genów ''ułożonych liniowo''. To tak jak kolejne zdania w opowiadaniu. Zaczynają się dużą literą (kodon start) a kończą kropką (kodon stop).

ale wysyła 'sygnały' za pomocą małych wypustek w cytoplaźmie - mRNA, tzw. messengerem.

To nie są wypuski tylko kopie DNA.

Wszystko jest możliwe......

 Zobacz profil  
PostNapisane: 7 wrz 2010, o 20:11 

Dołączył(a): 4 wrz 2010, o 16:56
Posty: 4
Płeć: brak
Gadu-Gadu: 0
Witam !

Z góry dziękuję za odpowiedź !

1) Nić komplementarna to inaczej nić kodująca.
2) Nić komlepentarna to nić wiodąca, a może jest nią matrycowa ?

Znasz następującą sekwencję aminokwasów : ASP. HIS. SER. LEU.
a) Wskaż nić mRNA, na której ten peptyd powstał.
b) Wskaż nić wiodącą DNA

Najpierw podaję nić ( jaką ? ) mRNA :

GAUCAUUCUUUA ( na podstawie tabeli) Czy na tej nici mam pisać START i STOP oraz nazwy trójek nukleotydów ?

I teraz jaj nazwać tą drugą nić, którą będę tworzyć do mRNA ?
CUAGUAAGAAAU Czy coś tu zaznaczam ?

B) Teraz nie wiem, którą nić obrać za bazę do utoworzenia owego podpunktu ...

* Chciałam także zapytać po co koduje się owe białka ? W obronie czy ochronie przed czym ?

Bardzo dziękuję za pomoc !

 Zobacz profil  
PostNapisane: 8 wrz 2010, o 15:27 
Avatar użytkownika

Dołączył(a): 13 lut 2007, o 14:01
Posty: 3819
Lokalizacja: Siedlce
Płeć: Kobieta
1) Nić komplementarna to inaczej nić kodująca.

Do nici kodującej komplementarna jest nić matrycowa
Do nici matrycowej komplementarna jest nić kodująca
Zależy którą masz podaną w zadaniu.

2) Nić komlepentarna to nić wiodąca, a może jest nią matrycowa ?

Replikacja nici DNA odbywa się w obu kierunkach więc raz nicią wiodącą jest matryca a raz nić kodująca.

Znasz następującą sekwencję aminokwasów : ASP. HIS. SER. LEU.
a) Wskaż nić mRNA, na której ten peptyd powstał.


CTAGTAAGAATT - DNA nic matrycowa
GATCATTCTTAA - DNA nić kodująca

Czy na tej nici mam pisać START i STOP oraz nazwy trójek nukleotydów ?

Po co ja pisałam wcześniejsze posty?
Niestouje się dodawania kodonów start i stop, chyba że nauczyciel twój tego wymaga.

I teraz jaj nazwać tą drugą nić, którą będę tworzyć do mRNA ?
CUAGUAAGAAAU Czy coś tu zaznaczam ?

Nauczyciel aby sprawdzić czy wiesz i rozumiesz każe ci na podstawie RNA stworzyć nić DNA czyli przeprowadzić odwrotną transkrypcję.
Jeśli rozumiesz transkrypcję to to jest odwrotnie.

Teraz nie wiem, którą nić obrać za bazę do utoworzenia owego podpunktu ...

masz matrycową to tworzysz kodującą
b) Wskaż nić wiodącą DNA

Pojęcie nici wiodącej dotyczy replikacji a to nie ma związku z biosyntezą białka.

* Chciałam także zapytać po co koduje się owe białka ? W obronie czy ochronie przed czym ?

Dlaczego nie czytasz postów?
Po to by tworzyć białka: strukturalne (budujące), funkcjonalne (enzymy, hormony) Wszystko inne możemy pobrać i wbudować. Białka tworzymy. Dzięki temu rozwijamysię, rośniemy,....

Jak zjesz czekoladę to w komórkach twojej trzustki zachodzi transkrypcja genu kodującego insulinę i translacja dzięki której powstaje białko - insulina.
Poczytajsobie o roli białek. Informacja o budowie naszych białek zawarta jest w DNA.

Bardzo dziękuję za pomoc !

Wszystko jest możliwe......

 Zobacz profil  
PostNapisane: 4 wrz 2011, o 11:01 

Dołączył(a): 4 wrz 2011, o 10:55
Posty: 2
Płeć: brak
Gadu-Gadu: 0
Witam, mam pytanie..
Dlaczego w definicji genu nie uwzględniono kolejności nukleotydów w kwasie RNA? baardzo proszę o szybką odpowiedź ;)

 Zobacz profil  
PostNapisane: 20 lut 2013, o 01:38 

Dołączył(a): 20 lut 2013, o 01:34
Posty: 2
Płeć: brak
Gadu-Gadu: 0
malgosi35, Dobry wieczor pisze z taka prosba czy mogla bys mi pomoc w napisaniu nici komplementarnej?? Siedze nad tym zadaniem i kilkoma jeszcze od 20 i wymiekam.
Z gory dziekuje za pomoc

 Zobacz profil  
Wyświetl posty nie starsze niż:  Sortuj wg  
Utwórz nowy wątek Odpowiedz w wątku  [ Posty: 10 ] 

Kto przegląda forum

Użytkownicy przeglądający ten dział: Brak zidentyfikowanych użytkowników

Nie możesz rozpoczynać nowych wątków
Nie możesz odpowiadać w wątkach
Nie możesz edytować swoich postów
Nie możesz usuwać swoich postów
Nie możesz dodawać załączników

Skocz do:  
Poznaj kierunki studiów, opinie studentów, pytania i odpowiedzi maturzystów na
(informator na temat kierunków: biologia, biotechnologia, medycyna, weterynaria, ochrona środowiska, mikrobiologia...)

W naszym portalu:  Zoologia i zwierzęta | olimpiada ekologiczna | Mikroskopy
Matura 2014: matura z biologii, arkusze maturalne z biologii, testy maturalne z biologii, testy z biologii, Wyniki próbnej matury z matematyki, Kursy przygotowawcze na studia medyczne, Kursy przygotowawcze do matury 2014
Aktualne na forum: jak zrobić zielnik, świńska grypa w Polsce, Zadania domowe z biologii, Edukacja ekologiczna

Na bazie phpBB
© Platforma edukacyjna BIOAREA | Ogólnopolski Dziennik BIOLOG
Redakcja | REKLAMA | Regulamin, ochrona prywatności
Letnia Szkoła Mikroskopii Optycznej 2014

Cena: 5,00 zł
Śląski Uniwersytet Medyczny w Katowicach
Gdański Uniwersytet Medyczny
Uniwersytet Medyczny w Lublinie
Uniwersytet Medyczny w Łodzi
Uniwersytet Medyczny w Poznaniu
Warszawski Uniwersytet Medyczny
Pomorski Uniwersytet Medyczny
Akademia Medyczna we Wrocławiu
Collegium Medicum w Bydgoszczy
Collegium Medicum Uniwersytetu Jagiellońskiego
Uniwersytet Warmińsko-Mazurski w Olsztynie
Uniwersytet Medyczny w Białymstoku
 Oferty pracy
 Znajdź pracę (350328 ofert pracy)



  Praca dla biologa, praca dla biotechnologa, praca dla nauczyciela
Na skróty: matura 2014, progi, limity, arkusze maturalne, przecieki

przewodnik dla maturzystów - kierunki studiów studia biologia studia biotechnologia leśnictwo studia medycyna studia ochrona środowiska studia weterynaria studia studia