Przyrodnicze forum dyskusyjne

Utwórz nowy wątek Odpowiedz w wątku  [ Posty: 14 ] 
Autor Wiadomość
PostNapisane: 4 wrz 2010, o 18:29 

Dołączył(a): 4 wrz 2010, o 16:56
Posty: 4
Płeć: brak
Witam !

Chciałabym zapytać czy dobrze rozmuję to oto zadanie :

1) Kolejność nukleotydów w pewnej nici DNA jest następująca : ACTTGCAAAGCCTATAGAAC

a) Dopisz nić komplementarną DNA :
Nić matrycowa DNA :
Nić komlementarna DNA :

b) Dopisz nić komplementarną RNA :

Czyli powtórnie przepisuję nić matrycową DNA ?
Nić komplementarna RNA :
Wydaje mi się, iż tutaj nastąpiła transkrypcja - czy mam rację ? Czy muszę na nici RNA dopisać tutaj start i stop oraz podpisać trójki nukleotydów ?

Z góry dziękuję za pomoc !

PostNapisane: 4 wrz 2010, o 20:17 
Avatar użytkownika

Dołączył(a): 13 lut 2007, o 14:01
Posty: 3873
Lokalizacja: Siedlce
Płeć: Kobieta
pytajnikkk napisał(a):
Witam !

Chciałabym zapytać czy dobrze rozmuję to oto zadanie :

1) Kolejność nukleotydów w pewnej nici DNA jest następująca : ACTTGCAAAGCCTATAGAAC

a) Dopisz nić komplementarną DNA :
Nić matrycowa DNA :
Nić komlementarna DNA :

b) Dopisz nić komplementarną RNA :

Czyli powtórnie przepisuję nić matrycową DNA ?
Nić komplementarna RNA :
Wydaje mi się, iż tutaj nastąpiła transkrypcja - czy mam rację ?
Czy muszę na nici RNA dopisać tutaj start i stop oraz podpisać trójki nukleotydów ?

PostNapisane: 4 wrz 2010, o 22:29 

Dołączył(a): 4 wrz 2010, o 16:56
Posty: 4
Płeć: brak
b) Dopisz nić komplementarną RNA :

Czyli powtórnie przepisuję nić matrycową DNA ?
Nić komplementarna RNA :

Dlaczego ten wytłuszczony fragment jest źle ? Skoro przepisuję z DNA na RNA to na RNA mam A-U i C-G, prawda ? I dlaczego na owej nici nie piszę START, STOP oraz nie podpisuję trójek nukleotydów ?

Dziękuję !

PostNapisane: 4 wrz 2010, o 23:04 
Avatar użytkownika

Dołączył(a): 13 lut 2007, o 14:01
Posty: 3873
Lokalizacja: Siedlce
Płeć: Kobieta
Czyli powtórnie przepisuję nić matrycową DNA ?
Dlaczego powtórnie? To jest tylko zadanie sprawdzające czy znasz zasady kodowania informacji genetycznej. Tworzenie komplementarnej nici DNA to właśnie sprawdzenie czy wiesz o co chodzi
I dlaczego na owej nici nie piszę START, STOP oraz nie podpisuję trójek nukleotydów ?
Bo to jest zadanie. Średnia długość genu np. u człowieka to 1000 nukleotydów a nie 20 jak w twoim i jest to fragment nici DNA a nie gen

PostNapisane: 5 wrz 2010, o 12:12 

Dołączył(a): 4 wrz 2010, o 16:56
Posty: 4
Płeć: brak
Witam !

Z góry dziękuję za odpowiedź !

Chciałam zapytać jeszcze o jedno : wiemy, ze DNA jest dwuniciowe i zawiera w sobie informację genetyczną danego osobnika oraz mieści się w jądrze komórkowym i nie może go opuścić, ale wysyła 'sygnały' za pomocą małych wypustek w cytoplaźmie - mRNA, tzw. messengerem.

Moje pytanie brzmi :
a) Czym różni się nić matrycowa od komplementarnej ?
b) W jakim celu dokonuje się tworzenia tych doatkowych nici czyli kolejnego przepisania ? Po to by geny się rozprzestrzeniły po organiźmie ? Nie rozumiem istosty transkrypcji i translacji.
c) Czy mylę się myśląc iż, DNA buduje gen ? Czym różni się DNA od genu, że na pierwszym nie zaznaczamy START/STOP czy nie oznaczamy trójek nukleotydów ?

Dziękuję !

PostNapisane: 6 wrz 2010, o 19:41 
Avatar użytkownika

Dołączył(a): 13 lut 2007, o 14:01
Posty: 3873
Lokalizacja: Siedlce
Płeć: Kobieta
a) Czym różni się nić matrycowa od komplementarnej ?

nić komplementarna to inaczej nić kodująca. Na niej właśnie jest zakodowany dany gen (geny). Przepisujemy z matrycowej by na mRNA była taka sama informacja jak w DNA.
Jądro to ,,sejf'' w którym jest przechowywana informacja genetyczna (plany). Ta informacja będzie wielokrotnie wykorzystywana przy produkcji różnych białek.
DNA ma dwie nici - to tak jakby był oryginał informacji i kopia (negatyw)

b) W jakim celu dokonuje się tworzenia tych doatkowych nici czyli kolejnego przepisania ?

Fabryka białka znajduje się w cytoplażmie - to rybosomy. Białka muszą być tworzone na podstawie planów, te plany są w sejfie (jądrze). Musimy zrobić kopię, która jako jednoniciowa bez problemu opuści jądro i podąży do rybosomów (fabryki). tą kopią jest pojedyńcza cząsteczka mRNA. W rzeczywistości ma ona kodon start i stop. W zadaniach się tego nie uwzględnia.

Po to by geny się rozprzestrzeniły po organiźmie ? Nie rozumiem istosty transkrypcji i translacji.

Po to by tworzyć białka: strukturalne (budujące), funkcjonalne (enzymy, hormony) Wszystko inne możemy pobrać i wbudować. Białka tworzymy. Dzięki temu rozwijamysię, rośniemy,....

c) Czy mylę się myśląc iż, DNA buduje gen ? Czym różni się DNA od genu, że na pierwszym nie zaznaczamy START/STOP czy nie oznaczamy trójek nukleotydów ?

Człowiek w komórce ciała ma 46 chromosomów. Czyli ma 46 cząsteczek DNA. W każdej cząsteczce DNA jest wiele genów ''ułożonych liniowo''. To tak jak kolejne zdania w opowiadaniu. Zaczynają się dużą literą (kodon start) a kończą kropką (kodon stop).

ale wysyła 'sygnały' za pomocą małych wypustek w cytoplaźmie - mRNA, tzw. messengerem.

To nie są wypuski tylko kopie DNA.

PostNapisane: 7 wrz 2010, o 20:11 

Dołączył(a): 4 wrz 2010, o 16:56
Posty: 4
Płeć: brak
Witam !

Z góry dziękuję za odpowiedź !

1) Nić komplementarna to inaczej nić kodująca.
2) Nić komlepentarna to nić wiodąca, a może jest nią matrycowa ?

Znasz następującą sekwencję aminokwasów : ASP. HIS. SER. LEU.
a) Wskaż nić mRNA, na której ten peptyd powstał.
b) Wskaż nić wiodącą DNA

Najpierw podaję nić ( jaką ? ) mRNA :

GAUCAUUCUUUA ( na podstawie tabeli) Czy na tej nici mam pisać START i STOP oraz nazwy trójek nukleotydów ?

I teraz jaj nazwać tą drugą nić, którą będę tworzyć do mRNA ?
CUAGUAAGAAAU Czy coś tu zaznaczam ?

B) Teraz nie wiem, którą nić obrać za bazę do utoworzenia owego podpunktu ...

* Chciałam także zapytać po co koduje się owe białka ? W obronie czy ochronie przed czym ?

Bardzo dziękuję za pomoc !

PostNapisane: 8 wrz 2010, o 15:27 
Avatar użytkownika

Dołączył(a): 13 lut 2007, o 14:01
Posty: 3873
Lokalizacja: Siedlce
Płeć: Kobieta
1) Nić komplementarna to inaczej nić kodująca.

Do nici kodującej komplementarna jest nić matrycowa
Do nici matrycowej komplementarna jest nić kodująca
Zależy którą masz podaną w zadaniu.

2) Nić komlepentarna to nić wiodąca, a może jest nią matrycowa ?

Replikacja nici DNA odbywa się w obu kierunkach więc raz nicią wiodącą jest matryca a raz nić kodująca.

Znasz następującą sekwencję aminokwasów : ASP. HIS. SER. LEU.
a) Wskaż nić mRNA, na której ten peptyd powstał.


CTAGTAAGAATT - DNA nic matrycowa
GATCATTCTTAA - DNA nić kodująca

Czy na tej nici mam pisać START i STOP oraz nazwy trójek nukleotydów ?

Po co ja pisałam wcześniejsze posty?
Niestouje się dodawania kodonów start i stop, chyba że nauczyciel twój tego wymaga.

I teraz jaj nazwać tą drugą nić, którą będę tworzyć do mRNA ?
CUAGUAAGAAAU Czy coś tu zaznaczam ?

Nauczyciel aby sprawdzić czy wiesz i rozumiesz każe ci na podstawie RNA stworzyć nić DNA czyli przeprowadzić odwrotną transkrypcję.
Jeśli rozumiesz transkrypcję to to jest odwrotnie.

Teraz nie wiem, którą nić obrać za bazę do utoworzenia owego podpunktu ...

masz matrycową to tworzysz kodującą
b) Wskaż nić wiodącą DNA

Pojęcie nici wiodącej dotyczy replikacji a to nie ma związku z biosyntezą białka.

* Chciałam także zapytać po co koduje się owe białka ? W obronie czy ochronie przed czym ?

Dlaczego nie czytasz postów?
Po to by tworzyć białka: strukturalne (budujące), funkcjonalne (enzymy, hormony) Wszystko inne możemy pobrać i wbudować. Białka tworzymy. Dzięki temu rozwijamysię, rośniemy,....

Jak zjesz czekoladę to w komórkach twojej trzustki zachodzi transkrypcja genu kodującego insulinę i translacja dzięki której powstaje białko - insulina.
Poczytajsobie o roli białek. Informacja o budowie naszych białek zawarta jest w DNA.

Bardzo dziękuję za pomoc !

PostNapisane: 4 wrz 2011, o 11:01 

Dołączył(a): 4 wrz 2011, o 10:55
Posty: 2
Płeć: brak
Witam, mam pytanie..
Dlaczego w definicji genu nie uwzględniono kolejności nukleotydów w kwasie RNA? baardzo proszę o szybką odpowiedź ;)

PostNapisane: 20 lut 2013, o 01:38 

Dołączył(a): 20 lut 2013, o 01:34
Posty: 2
Płeć: brak
malgosi35, Dobry wieczor pisze z taka prosba czy mogla bys mi pomoc w napisaniu nici komplementarnej?? Siedze nad tym zadaniem i kilkoma jeszcze od 20 i wymiekam.
Z gory dziekuje za pomoc

PostNapisane: 15 gru 2014, o 17:30 

Dołączył(a): 15 gru 2014, o 17:23
Posty: 1
Płeć: brak
Witam, mam zadanie: Podano fragment DNA. Utwórz nić matrycową DNA i nić mRNA.
Dobrze je rozwiązałam?
5' TACGGGTATATG 3' - nić kodująca
3' ATGCCCATATAC 5' - nić matrycowa DNA

PostNapisane: 16 gru 2014, o 19:10 

Dołączył(a): 24 wrz 2010, o 12:58
Posty: 3124
Płeć: Kobieta

PostNapisane: 20 sty 2015, o 19:35 
Avatar użytkownika

Dołączył(a): 5 lis 2013, o 17:16
Posty: 17
Płeć: Mężczyzna
A ja mam takie pytanie z transkrypcji, Mam w notatce z lekcji "(...) gotowy mRNA odłącza się od DNA i u eukariantów ulega modyfikacji, po czym opuszcza jądro i przemieszcza się do rybosomów." Pytanie: dlaczego ulego modyfikacji? O co chodzi?

PostNapisane: 20 sty 2015, o 19:52 
Avatar użytkownika

Dołączył(a): 26 cze 2012, o 20:19
Posty: 3257
Lokalizacja: Komórki nabłonkowe jelita
Płeć: Mężczyzna

Utwórz nowy wątek Odpowiedz w wątku  [ Posty: 14 ] 

Poznaj kierunki studiów, opinie studentów, pytania i odpowiedzi maturzystów na
(informator na temat kierunków: biologia, biotechnologia, medycyna, weterynaria, ochrona środowiska, mikrobiologia...)

W naszym portalu:  Zoologia i zwierzęta | olimpiada ekologiczna | Mikroskopy
Matura 2014: matura z biologii, arkusze maturalne z biologii, testy maturalne z biologii, testy z biologii, Wyniki próbnej matury z matematyki, Kursy przygotowawcze na studia medyczne, Kursy przygotowawcze do matury 2014
Aktualne na forum: jak zrobić zielnik, świńska grypa w Polsce, Zadania domowe z biologii, Edukacja ekologiczna

Na bazie phpBB
© Platforma edukacyjna BIOAREA | Ogólnopolski Dziennik BIOLOG
Redakcja | REKLAMA | Regulamin, ochrona prywatności