Przyrodniczy serwis edukacyjny
Ogólnopolski Dziennik BIOLOG - strona główna Największe polskie forum przyrodnicze i naukowe Korepetycje Matura 2013 Studia 2013 Ściągi Baza konkursów Festiwale naukowe Książki Księgarnia Fotografia przyrodnicza Multimedia Praca forum przyrodnicze
   Bądź na bieżąco z wydarzeniami, subskrybuj kanały RSS
     Zobacz inne kanały tematyczne RSS dziennika BIOLOG
   Forumowe dyskusje » Chat
Aktualności naukowe Biotechnologia Botanika Nauka w Polsce i na świecie Ekologia Leśnictwo Medycyna Zoologia Encyklopedia naukowa GMO - Organizmy modyfikowane genetycznie Świńska grypa forum naukowe
Teraz jest 23 kwi 2014, o 17:14

Utwórz nowy wątek Odpowiedz w wątku  [ Posty: 16 ]  Przejdź na stronę 1, 2  Następna strona
Autor Wiadomość
PostNapisane: 9 maja 2009, o 12:52 
Avatar użytkownika

Dołączył(a): 5 lut 2009, o 15:57
Posty: 35
Lokalizacja: łódź
Płeć: brak
pomocy, przed matura zaczyna mi sie wszystko mieszac. czy ja dobrze rozumiem cala ta biosynteze?

białko: Met-Arg-Ser


 Zobacz profil  
PostNapisane: 9 maja 2009, o 12:56 
Avatar użytkownika

Dołączył(a): 19 gru 2008, o 20:22
Posty: 636
Lokalizacja: Lublin
Płeć: Kobieta
Gadu-Gadu: 0
Przepisanie informacji z DNA na mRNA w porządku. Nie znam na pamięć jakie aminokwasy są kodowane przez dany kodon ale jeżeli te to w porządku.

 Zobacz profil  
PostNapisane: 9 maja 2009, o 13:00 
Avatar użytkownika

Dołączył(a): 5 lut 2009, o 15:57
Posty: 35
Lokalizacja: łódź
Płeć: brak
hmmm no wlasnie chodzi mi o te aminokwasy. kodon AUG koduje metionine. i teraz ten kodon ma być na mRNA czy ma byc antykodonem... czuje sie zagubiony a jeszcze niedawno bylo to prostackie ;]

 Zobacz profil  
PostNapisane: 9 maja 2009, o 13:05 
Avatar użytkownika

Dołączył(a): 19 gru 2008, o 20:22
Posty: 636
Lokalizacja: Lublin
Płeć: Kobieta
Gadu-Gadu: 0
W tabeli kodu genetycznego szukasz takich trójek jakie masz w mRNA.
AUG metionina
CGA arginina
AGU - seryna

czyli wszystko się zgadza.

 Zobacz profil  
PostNapisane: 9 maja 2009, o 13:40 
Avatar użytkownika

Dołączył(a): 13 lut 2007, o 14:01
Posty: 3819
Lokalizacja: Siedlce
Płeć: Kobieta
Jeszcze pytanie: Która nić DNA: matrycowa czy kodująca

Wszystko jest możliwe......

 Zobacz profil  
PostNapisane: 9 maja 2009, o 13:55 
Avatar użytkownika

Dołączył(a): 5 lut 2009, o 15:57
Posty: 35
Lokalizacja: łódź
Płeć: brak
no tak, w pewnym zadaniu mam podane:


i teraz od ktorej nici powstanie mRNA? bedzie ona komplementarna z 3'OH?
i ktora jest matrycowa a ktora kodujaca?

 Zobacz profil  
PostNapisane: 9 maja 2009, o 14:25 

Dołączył(a): 25 sty 2008, o 00:03
Posty: 329
Lokalizacja: z biol.-medu :)
Płeć: Kobieta
Gadu-Gadu: 0
Nić matrycowa ma 3' - 5'
Nić niematrycowa ma 5'- 3'

mRNA jest komplementarny do nici matrycowej. Sekewecja nukleotydów na mRNA jest taka sama jak w nici niematrycowej, jedynie T zamienia się na U i odwrotnie. :)

'Nauczać- to pokazywać, że coś jest możliwe.
Uczyć się- to poznawać własne możliwości.'

P. Coelho 'Pielgrzym'

 Zobacz profil  
PostNapisane: 9 maja 2009, o 14:28 
Avatar użytkownika

Dołączył(a): 4 sty 2008, o 16:47
Posty: 950
Lokalizacja: PL
Płeć: Mężczyzna
Gadu-Gadu: 0
cyberh napisał(a):

3' TAC-CGA-TCA 5' - nić matrycowa
5' ATG-GCT-AGT 3' - nić niematrycowa, kodująca, sensowna
Synteza RNA jest zawsze w kierunku 5'--->3' więc matrycą będzie jedna z nici DNA o polarności 3'--->5'
mRNA 5' AUG-GCU-AGU 3', polipeptyd: Met-Ala-Ser

 Zobacz profil  
PostNapisane: 27 sty 2010, o 13:23 

Dołączył(a): 26 sty 2010, o 21:37
Posty: 18
Płeć: brak
Gadu-Gadu: 0
Czy schemat biosyntezy mRNA to po prostu schemat translacji?

 Zobacz profil  
PostNapisane: 27 sty 2010, o 15:38 
Avatar użytkownika

Dołączył(a): 12 sty 2007, o 14:53
Posty: 988
Lokalizacja: Warszawa
Płeć: Mężczyzna
Gadu-Gadu: 0
Nie biosyntezy mRNA, tylko biostyntezy białka. Tak,translacja jest właściwą biosyntezą białka.

Ignorance more frequently begets confidence than does knowledge: it is those who know little, not those who know much, who so positively assert that this or that problem will never be solved by science. - Charles Darwin

 Zobacz profil  
PostNapisane: 27 sty 2010, o 16:03 

Dołączył(a): 26 sty 2010, o 21:37
Posty: 18
Płeć: brak
Gadu-Gadu: 0
Czy więc pytanie "Przedstaw schemat biosyntezy mRNA" jest nie poprawne z punktu widzenia biochemicznego??

 Zobacz profil  
PostNapisane: 27 sty 2010, o 18:45 
Avatar użytkownika

Dołączył(a): 12 sty 2007, o 14:53
Posty: 988
Lokalizacja: Warszawa
Płeć: Mężczyzna
Gadu-Gadu: 0
julcia2pl napisał(a):
Czy więc pytanie "Przedstaw schemat biosyntezy mRNA" jest nie poprawne z punktu widzenia biochemicznego??

Jeśli autor miał na myśli translację to tak, bo tu chodzi o transkrypcję.

Ignorance more frequently begets confidence than does knowledge: it is those who know little, not those who know much, who so positively assert that this or that problem will never be solved by science. - Charles Darwin

 Zobacz profil  
PostNapisane: 28 sty 2010, o 15:04 

Dołączył(a): 26 sty 2010, o 21:37
Posty: 18
Płeć: brak
Gadu-Gadu: 0
Transkrypcja czyli inicjacja,elongacja,terminacja no właśnie w kilku książkach (nie w każdej którą przejrzałam)znalazłam,że należy dodać jeszcze aktywację aminokwasu.
Więc jak to jest?

 Zobacz profil  
PostNapisane: 29 sty 2010, o 00:12 

Dołączył(a): 14 cze 2009, o 18:41
Posty: 142
Płeć: brak
Biosynteza mRNA to jaknajbardziej proces transkrypcji. Rozpoczyna sie od rozpoznania promotora na nici matrycowej, zaladowaniu kompleksu polimerazy RNA na nic i rozpoczeciu transkrypcji. Holoenzym - bo tak nazywac mozna polimeraze RNA, ktora tworza dwie podjednostki alfa, beta, beta' i sigma, syntetyzuje nowy lancuch rybonukleotydowy na matrycy DNA, stad czesto nazwa DNA zalezna polimeraza RNA.
Nie wiem czy to nie namiesza za bardzo... ale to ktora nic jest kodujaca nie zalezy od zapisu jak na powyzszych przykladach, a od tego gdzie zostanie rozpoznany promotor. Pewne jest jedno - synteza RNA przebiega tak samo jak DNA czyli w kierunku od 5' do 3'. Zatem jesli piszesz od lewej do prawej to po lewej zawsze 5'. To ktora nic bedzie kodujaca powinno byc wyraznie napisane w zadaniu - to tylko moja opinia ;) . Jesli RNA syntetyzowane jest 5'->3' to wlasciwie jego sekwencja bedzie identyczna jak lancuch DNA o odpowiedniej polaryzacji, oczywiscie ze zmienionym nuklotydem tymidynowym. Ta nic jest nicia kodujaca. Zatem:


5'GUACUGAUAAGCUGAAGCAUAG3' RNA powstaly na nici matrycowej o sekwencji takiej jak nic kodujaca.
Jako ze wymyslalem sekwencje tak sobie to troche skopalem. Translacji nie bedzie...Dlaczego - znajdzcie.
Tak czy siak polimeraza RNA syntetyzuje lancuch tak dlugo dopoki nie bedzie sygnalu terminacji transkrypcji - nie mylic z terminacja translacji dla ktorej sa 3 rozne kodony.
Aktywacja aminokwasu jakkolwiek by tego nie nazywac wiaze sie juz z translacja, dokladniej z tworzeniem tRNA-aminokwas. Proces ten zachodzi rownolegle. Nowoutworzone tRNA jest rozpoznawane przez odpowiednia syntetaze dzieki ramieniu akceptorowemu i antykodonowi. W dwuetapowej reakcji zostaje dodany aminokwas odpowiedniu do antykodonu na tRNA.

 Zobacz profil  
PostNapisane: 29 sty 2010, o 00:24 

Dołączył(a): 26 sty 2010, o 21:37
Posty: 18
Płeć: brak
Gadu-Gadu: 0
Tak więc wątpliwości rozwiane:) Tak to jest jak się ma za dużo źródeł informacji. Zgłupieć idzie:) Dziękuje
Mam jeszcze jedno pytanie nie mogę znaleźć interesujących mnie konkretów.Co to jest pierwotna synteza aminokwasów?? Co tutaj można postawić za przykład?

 Zobacz profil  
Wyświetl posty nie starsze niż:  Sortuj wg  
Utwórz nowy wątek Odpowiedz w wątku  [ Posty: 16 ]  Przejdź na stronę 1, 2  Następna strona

Kto przegląda forum

Użytkownicy przeglądający ten dział: Brak zidentyfikowanych użytkowników

Nie możesz rozpoczynać nowych wątków
Nie możesz odpowiadać w wątkach
Nie możesz edytować swoich postów
Nie możesz usuwać swoich postów
Nie możesz dodawać załączników

Skocz do:  
Poznaj kierunki studiów, opinie studentów, pytania i odpowiedzi maturzystów na
(informator na temat kierunków: biologia, biotechnologia, medycyna, weterynaria, ochrona środowiska, mikrobiologia...)

W naszym portalu:  Zoologia i zwierzęta | olimpiada ekologiczna | Mikroskopy
Matura 2014: matura z biologii, arkusze maturalne z biologii, testy maturalne z biologii, testy z biologii, Wyniki próbnej matury z matematyki, Kursy przygotowawcze na studia medyczne, Kursy przygotowawcze do matury 2014
Aktualne na forum: jak zrobić zielnik, świńska grypa w Polsce, Zadania domowe z biologii, Edukacja ekologiczna

Na bazie phpBB
© Platforma edukacyjna BIOAREA | Ogólnopolski Dziennik BIOLOG
Redakcja | REKLAMA | Regulamin, ochrona prywatności
Letnia Szkoła Mikroskopii Optycznej 2014

Cena: 5,00 zł
Śląski Uniwersytet Medyczny w Katowicach
Gdański Uniwersytet Medyczny
Uniwersytet Medyczny w Lublinie
Uniwersytet Medyczny w Łodzi
Uniwersytet Medyczny w Poznaniu
Warszawski Uniwersytet Medyczny
Pomorski Uniwersytet Medyczny
Akademia Medyczna we Wrocławiu
Collegium Medicum w Bydgoszczy
Collegium Medicum Uniwersytetu Jagiellońskiego
Uniwersytet Warmińsko-Mazurski w Olsztynie
Uniwersytet Medyczny w Białymstoku
 Oferty pracy
 Znajdź pracę (350328 ofert pracy)



  Praca dla biologa, praca dla biotechnologa, praca dla nauczyciela
Na skróty: matura 2014, progi, limity, arkusze maturalne, przecieki

przewodnik dla maturzystów - kierunki studiów studia biologia studia biotechnologia leśnictwo studia medycyna studia ochrona środowiska studia weterynaria studia studia