Dziwne zadanie matura 2015 - Nowa.

Rozmowy na temat matury z biologii. odpowiedzi na trudne pytania, rozwiązywanie zadań, arkusze maturalne z biologii
Illuminati
Posty: 1
Rejestracja: 31 paź 2016, o 08:37

Dziwne zadanie matura 2015 - Nowa.

Post autor: Illuminati » 31 paź 2016, o 08:48

Cząsteczka insuliny składa się z dwóch różnych łańcuchów polipeptydowych – A i B.
Występują w niej trzy mostki dwusiarczkowe stabilizujące strukturę cząsteczki: jeden
w łańcuchu polipeptydowym A oraz dwa – łączące łańcuchy A i B. Początek sekwencji
kodującej (znajdującej się na nici nieulegającej transkrypcji) genu kodującego jeden

z łańcuchów polipeptydowych insuliny jest następujący:
5’ ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCG … 3’.
Podczas eksperymentu użyto czynnika mutagennego, który w dwu przypadkach wywołał
delecje, tzn. transkrybowane mRNA było pozbawione fragmentu sekwencji składającego się
z kolejnych nukleotydów. W wyniku translacji powstały łańcuchy polipeptydowe (1. i 2.)
o innej sekwencji aminokwasów niż w łańcuchu prawidłowym.
I. przypadek – polipeptyd 1. powstał na podstawie delecji 4 nukleotydów (od 10 do 13
nukleotydu sekwencji kodującej włącznie)
II. przypadek – polipeptyd 2. powstał na podstawie delecji 9 nukleotydów (

Podaj nazwę czwartego aminokwasu w sekwencji prawidłowego polipeptydu oraz nazwę
czwartego aminokwasu w polipeptydzie 1. Przyjmij założenie, że w ich skład nie wchodzi
aminokwas kodowany przez kodon START.

Polipeptyd prawidłowy: .
Polipeptyd 1:

Odpowiedzi:
polipeptyd prawidłowy: metionina
polipeptyd 1.: alanina

Aktualnie moje matury wychodzą mi w wyniku około 70%, ale tego zadania za nic nie mogę rozwiązać. Za każdym razem wychodzi mi źle. Prawdopodobnie przeoczyłem coś oczywistego, ale nie mam pojęcia.

Kodon odpowiadający za metioninę w większości przypadków to AUG. W wypadku mitochondriów jest to chociażby wyjątek, w tym przypadku w książce o tym nie mam tu nic.

Jest to sekwencje, która nie ulega transkrypcji.
GCG- faktycznie jest to Alanina.
Ale ATG? Antykodon ATG- UAC? Nie jest to w żadnym wypadku mietonina. CGC - 4 aminokwas. Antykodon daje GCG czyli Alaninę.

Może coś pokręciłem z tą transkrypcją.
Podczas transkrypcji powstaje mRNA, z którego potem odczytywana jest informacja genetyczna. W tym przypadku informacja nie jest odczytywana z mRNA tylko bezpośrednio z tego łańcucha?

persil1991
Posty: 1673
Rejestracja: 22 maja 2008, o 22:21

Re: Dziwne zadanie matura 2015 - Nowa.

Post autor: persil1991 » 12 lis 2016, o 16:12

5’ ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCG … 3’ - to jest nić DNA, która nie ulega transkrypcji
3’ TACCGGGACACCTACGCGGAGGACGGGGACGACCGC … 5’ - teraz powstała mi druga nić DNA, która ulega transkrypcji (komplementarna do powyższej)
5’ AUGGCCCUGUGGAUGCGCCUCCUGCCCCUGCUGGCG … 3’ - teraz powstał mi prawidłowy mRNA
5’ AUGGCCCUGUGCGCCUCCUGCCCCUGCUGGCG … 3’ - teraz powstał mi mRNA po zadziałaniu czynnika mutagennego (utrata nukleotydów: od dziesiątego do trzynastego)

Na podstawie prawidłowego mRNA powstaje polipeptyd:
AUG GCC CUG UGG AUG ., czyli: START - alanina - leucyna - tryptofan - metionina - .

Na podstawie zmienionego mutagennie mRNA powstaje polipeptyd:
AUG GCC CUG UGC GCC ., czyli START - alanina - leucyna - cysteina - alanina - .

ODPOWIEDZ
  • Podobne tematy
    Odpowiedzi
    Odsłony
    Ostatni post

Kto jest online

Użytkownicy przeglądający to forum: Obecnie na forum nie ma żadnego zarejestrowanego użytkownika i 1 gość